![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-326 |
|||||
Accession | MI0000808 (change log) | ||||
Symbol | HGNC:MIR326 | ||||
Description | Homo sapiens miR-326 stem-loop | ||||
Gene family | MIPF0000143; mir-326 | ||||
Literature search |
![]()
75 open access papers mention hsa-mir-326 | ||||
Stem-loop |
cuc guu c uugu a -g g 5' aucugucu gggcuggagg agggccu ga ggcgg ug u |||||||| |||||||||| ||||||| || ||||| || g 3' uaggcgga cccgaccucc ucccggg cu ccgcu ac c acu -gc u ---u - ag u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3]. miR-326 cloned in [3] has a 1 nt 3' extension (U), which is incompatible with the genome sequence. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-326 |
|
Accession | MIMAT0000756 |
Sequence |
60 - ccucugggcccuuccuccag - 79 |
Deep sequencing | 7980 reads, 131 experiments |
Evidence | experimental; cloned [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|