Stem-loop sequence hsa-mir-326

AccessionMI0000808 (change log)
Symbol HGNC:MIR326
DescriptionHomo sapiens miR-326 stem-loop
Gene family MIPF0000143; mir-326
Literature search

75 open access papers mention hsa-mir-326
(392 sentences)

Stem-loop 
   cuc        guu          c       uugu  a     -g  g 
5'    aucugucu   gggcuggagg agggccu    ga ggcgg  ug u
      ||||||||   |||||||||| |||||||    || |||||  || g
3'    uaggcgga   cccgaccucc ucccggg    cu ccgcu  ac c
   acu        -gc          u       ---u  -     ag  u
Get sequence
Deep sequencing
8067 reads, 14.2 reads per million, 141 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3]. miR-326 cloned in [3] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 75335092-75335186 [-]
sense
OTTHUMT00000383527 ; MAP6-001; intron 1
OTTHUMT00000383538 ; MAP6-004; intron 1
OTTHUMT00000383541 ; MAP6-002; intron 1
ENST00000304771 ; MAP6-001; intron 1
ENST00000526740 ; MAP6-004; intron 1
ENST00000434603 ; MAP6-002; intron 1
Database links

Mature sequence hsa-miR-326

Accession MIMAT0000756
Sequence

60 -  

ccucugggcccuuccuccag

 - 79

Get sequence
Deep sequencing7980 reads, 131 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).