MIR148B is a type of microRNA that has been observed in serum samples of breast cancer patients, where its concentration was generally found to be lower compared to controls [PMC9967215]. Specifically, the ratio of MIR148B was reported to be down in two instances, indicating a potential role in the pathogenesis or progression of breast cancer [PMC9967215]. Additionally, MIR148B is involved in the regulation of ACVR1/Alk-2 expression, which is a common trait among most microRNAs that were downregulated in the study [PMC3515447]. This regulatory function aligns with the broader understanding that microRNAs can act as oncogenes or tumor suppressors by modulating gene expression [PMC3515447].
                            caagcac  uu   a                  U  A    CA    guggc 
       ga  agc uuugaggugAAGUUCUGU AU CACU  GGCu     u
       ||  ||| |||||||||||||||||| || ||||  ||||     c
       cu  ucg aagcucUGUUUCAAGACA UA GUGA  CUga     u
-----au  -u   a                  C  C    --    aaguc 
            | Disease | Description | Category | PubMed ID | 
|---|
| Accession | MIMAT0004699 | 
| Description | Homo sapiens hsa-miR-148b-5p mature miRNA | 
| Sequence | 25 - AAGUUCUGUUAUACACUCAGGC - 46 | 
| Evidence | 
                                    experimental
                                    
                                     cloned [3]  | 
                            
| Database links | 
                                    
                                                
                                                     
                                 
                                       
                                        
                                           
                                          
                                           
                                        
                                           
                                          
                                           
                                       
                                   
                                 | 
| Predicted targets | 
                                        
                                          
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                         
                                        
                                
                                        
                                
                                        
                                
                                        
                                     | 
                                
| Accession | MIMAT0000759 | 
| Description | Homo sapiens hsa-miR-148b-3p mature miRNA | 
| Sequence | 63 - UCAGUGCAUCACAGAACUUUGU - 84 | 
| Evidence | 
                                    experimental
                                    
                                     cloned [3-4]  | 
                            
| Database links | 
                                    
                                                
                                                     
                                  
                                      
                                        
                                           
                                          
                                           
                                        
                                           
                                          
                                           
                                       
                                   
                                 | 
| Predicted targets | 
                                        
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                         
                                        
                                
                                        
                                
                                        
                                     | 
                                
                        
  |