Stem-loop sequence hsa-mir-335

Accession MI0000816
Symbol HGNC:MIR335
Description Homo sapiens miR-335 stem-loop
Gene family MIPF0000196; mir-335
Stem-loop 
-------u  -uu    c        a         c        u  gu 
        gu   ugag ggggguca gagcaauaa gaaaaaug uu  c
        ||   |||| |||||||| ||||||||| |||||||| ||   
        cg   acuc ccuccagu cucguuauu cuuuuugc aa  a
acuuauau  uuu    u        c         a        c  au
Get sequence
Deep sequencing
6570 reads, 37 experiments
Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr7: 130135952-130136045 [+]
sense
OTTHUMT00000345184 ; MEST-002; intron 2
OTTHUMT00000345194 ; MEST-006; intron 2
OTTHUMT00000345185 ; MEST-003; intron 2
OTTHUMT00000345186 ; MEST-004; intron 2
OTTHUMT00000345195 ; MEST-007; intron 2
OTTHUMT00000345196 ; MEST-008; intron 2
OTTHUMT00000345197 ; MEST-009; intron 2
OTTHUMT00000345183 ; MEST-001; intron 2
OTTHUMT00000345187 ; MEST-005; intron 2
OTTHUMT00000345200 ; MEST-012; intron 2
OTTHUMT00000345184 ; MEST-002; intron 2
OTTHUMT00000345194 ; MEST-006; intron 2
OTTHUMT00000345185 ; MEST-003; intron 2
OTTHUMT00000345186 ; MEST-004; intron 2
OTTHUMT00000345195 ; MEST-007; intron 2
OTTHUMT00000345196 ; MEST-008; intron 2
OTTHUMT00000345197 ; MEST-009; intron 2
OTTHUMT00000345183 ; MEST-001; intron 2
OTTHUMT00000345187 ; MEST-005; intron 2
OTTHUMT00000345200 ; MEST-012; intron 2
OTTHUMT00000345184 ; MEST-002; intron 2
OTTHUMT00000345194 ; MEST-006; intron 2
OTTHUMT00000345185 ; MEST-003; intron 2
OTTHUMT00000345186 ; MEST-004; intron 2
OTTHUMT00000345195 ; MEST-007; intron 2
OTTHUMT00000345196 ; MEST-008; intron 2
OTTHUMT00000345197 ; MEST-009; intron 2
OTTHUMT00000345183 ; MEST-001; intron 2
OTTHUMT00000345187 ; MEST-005; intron 2
OTTHUMT00000345200 ; MEST-012; intron 2
OTTHUMT00000345199 ; MEST-011; intron 3
OTTHUMT00000345199 ; MEST-011; intron 3
OTTHUMT00000345199 ; MEST-011; intron 3
ENST00000341441 ; MEST-002; intron 2
ENST00000427521 ; MEST-006; intron 2
ENST00000416162 ; MEST-003; intron 2
ENST00000378576 ; MEST-004; intron 2
ENST00000399874 ; MEST-007; intron 2
ENST00000433159 ; MEST-008; intron 2
ENST00000421001 ; MEST-009; intron 2
ENST00000223215 ; MEST-001; intron 2
ENST00000437945 ; MEST-005; intron 2
ENST00000458161 ; MEST-012; intron 2
ENST00000393187 ; MEST-201; intron 2
ENST00000341441 ; MEST-002; intron 2
ENST00000427521 ; MEST-006; intron 2
ENST00000416162 ; MEST-003; intron 2
ENST00000378576 ; MEST-004; intron 2
ENST00000399874 ; MEST-007; intron 2
ENST00000433159 ; MEST-008; intron 2
ENST00000421001 ; MEST-009; intron 2
ENST00000223215 ; MEST-001; intron 2
ENST00000437945 ; MEST-005; intron 2
ENST00000458161 ; MEST-012; intron 2
ENST00000393187 ; MEST-201; intron 2
ENST00000341441 ; MEST-002; intron 2
ENST00000427521 ; MEST-006; intron 2
ENST00000416162 ; MEST-003; intron 2
ENST00000378576 ; MEST-004; intron 2
ENST00000399874 ; MEST-007; intron 2
ENST00000433159 ; MEST-008; intron 2
ENST00000421001 ; MEST-009; intron 2
ENST00000223215 ; MEST-001; intron 2
ENST00000437945 ; MEST-005; intron 2
ENST00000458161 ; MEST-012; intron 2
ENST00000393187 ; MEST-201; intron 2
ENST00000437637 ; MEST-011; intron 3
ENST00000437637 ; MEST-011; intron 3
ENST00000437637 ; MEST-011; intron 3
Database links

Mature sequence hsa-miR-335-5p

Accession MIMAT0000765
Previous IDs hsa-miR-335
Sequence

16 -  

ucaagagcaauaacgaaaaaugu

 - 38

Get sequence
Deep sequencing 6477 reads, 30 experiments
Evidence experimental; cloned [3-4]
Validated targets
Predicted targets

Mature sequence hsa-miR-335-3p

Accession MIMAT0004703
Previous IDs hsa-miR-335*
Sequence

52 -  

uuuuucauuauugcuccugacc

 - 73

Get sequence
Deep sequencing 93 reads, 9 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).