Stem-loop sequence mmu-mir-335

Accession

MI0000817 (change log)

Symbol

MGI:Mir335

Description

Mus musculus miR-335 stem-loop

Gene family

MIPF0000196; mir-335

Literature search

65 open access papers mention mmu-mir-335
(327 sentences)

Stem-loop

   --------ucuuu    c        a         c        uuu    u 
5'              uggg ggggguca gagcaauaa gaaaaaug   guuu u
                |||| |||||||| ||||||||| ||||||||   |||| c
3'              acuc cccccagu cucguuauu cuuuuugc   caaa g
   accgauauugggu    u        c         a        ---    u 

Deep sequencing

248940 reads, 1.68e+03 reads per million, 84 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr6: 30741299-30741396 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000034125 ; Mest-009; intron 1

  OTTMUST00000034123 ; Mest-006; intron 2

  OTTMUST00000034121 ; Mest-004; intron 2

  OTTMUST00000034118 ; Mest-002; intron 2

  OTTMUST00000034117 ; Mest-001; intron 2

  OTTMUST00000034119 ; Mest-003; intron 3

  OTTMUST00000034122 ; Mest-005; intron 3

  ENSMUST00000137521 ; Mest-009; intron 1

  ENSMUST00000115127 ; Mest-006; intron 2

  ENSMUST00000147400 ; Mest-004; intron 2

  ENSMUST00000157040 ; Mest-002; intron 2

  ENSMUST00000128398 ; Mest-001; intron 2

  ENSMUST00000163949 ; Mest-201; intron 2

  ENSMUST00000151777 ; Mest-003; intron 3

  ENSMUST00000124665 ; Mest-005; intron 3

Database links

• EntrezGene:Mirn335
• MGI:Mir335
• RNAcentral:URS0000710A73_10090
• miRBase Tracker:MI0000817

Mature sequence mmu-miR-335-5p

• Accession: MIMAT0000766
• Previous IDs: mmu-miR-335
• Sequence: 16 - ucaagagcaauaacgaaaaaugu - 38
• Deep sequencing: 207528 reads, 84 experiments
• Evidence: experimental; cloned [3], Illumina [5-6]
• Database links:
  • RNAcentral:URS0000237AF9_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-335-5p
  • miRDB:mmu-miR-335-5p
  • microrna.org:mmu-miR-335-5p

Mature sequence mmu-miR-335-3p

• Accession: MIMAT0004704
• Sequence: 56 - uuuuucauuauugcuccugacc - 77
• Deep sequencing: 41401 reads, 67 experiments
• Evidence: experimental; cloned [3], Illumina [5-6]
• Database links:
  • RNAcentral:URS00005092C2_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-335-3p
  • miRDB:mmu-miR-335-3p
  • microrna.org:mmu-miR-335-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17687032 "Competing interactions between micro-RNAs determine neural progenitor survival and proliferation after ethanol exposure: evidence from an ex vivo model of the fetal cerebral cortical neuroepithelium" Sathyan P, Golden HB, Miranda RC J Neurosci. 27:8546-8557(2007).
5. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).