![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-335 |
|||||
Accession | MI0000817 (change log) | ||||
Symbol | MGI:Mir335 | ||||
Description | Mus musculus miR-335 stem-loop | ||||
Gene family | MIPF0000196; mir-335 | ||||
Literature search |
![]()
65 open access papers mention mmu-mir-335 | ||||
Stem-loop |
--------ucuuu c a c uuu u 5' uggg ggggguca gagcaauaa gaaaaaug guuu u |||| |||||||| ||||||||| |||||||| |||| c 3' acuc cccccagu cucguuauu cuuuuugc caaa g accgauauugggu u c a --- u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-335-5p |
|
Accession | MIMAT0000766 |
Previous IDs | mmu-miR-335 |
Sequence |
16 - ucaagagcaauaacgaaaaaugu - 38 |
Deep sequencing | 207528 reads, 84 experiments |
Evidence | experimental; cloned [3], Illumina [5-6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-335-3p |
|
Accession | MIMAT0004704 |
Sequence |
56 - uuuuucauuauugcuccugacc - 77 |
Deep sequencing | 41401 reads, 67 experiments |
Evidence | experimental; cloned [3], Illumina [5-6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 | |
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|