![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-133a-2 |
||||||
Accession | MI0000820 (change log) | |||||
Symbol | MGI:Mir133a-2 | |||||
Description | Mus musculus miR-133a-2 stem-loop | |||||
Gene family | MIPF0000029; mir-133 | |||||
Literature search |
![]()
236 open access papers mention mmu-mir-133a-2 | |||||
Stem-loop |
a aa ----ca uuu a aa u a -ag u 5' g gc aaugc gcug agcuggu aa gg accaaauc c g | || ||||| |||| ||||||| || || |||||||| | u 3' c cg uuacg cgau ucgacca uu cc ugguuuag g u a gc cacuag cgu g ac c c gua g |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
This mature miRNA sequence was named miR-133 in reference [1], and renamed miR-133a on subsequent identification of a homologue differing at the terminal 3' position (MI0000821). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-133a-5p |
|
Accession | MIMAT0003473 |
Previous IDs | mmu-miR-133a* |
Sequence |
23 - gcugguaaaauggaaccaaau - 43 |
Deep sequencing | 19809 reads, 47 experiments |
Evidence | experimental; MPSS [2], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-133a-3p |
|
Accession | MIMAT0000145 |
Previous IDs | mmu-miR-133a |
Sequence |
59 - uuugguccccuucaaccagcug - 80 |
Deep sequencing | 357949 reads, 76 experiments |
Evidence | experimental; cloned [1,3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|