Stem-loop sequence mmu-mir-133b

AccessionMI0000821
Symbol MGI:Mir133b
DescriptionMus musculus miR-133b stem-loop
Gene family MIPF0000029; mir-133
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   c       --gg    --g   --       c        ca  c  a      u  g      
5'  cuccaaa    gagu   gcc  cccugcu uggcuggu  aa gg accaag cc ucuuc 
    |||||||    ||||   |||  ||||||| ||||||||  || || |||||| || |||| c
3'  gagguuu    cucg   cgg  gggacga aucgacca  uu cc ugguuu gg agagu 
   a       auaa    aaa   uc       c        ac  c  c      -  -      
Get sequence
Deep sequencing
360633 reads, 5e+03 reads per million, 80 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-133b was predicted based on comparative analysis of human, mouse and Fugu [1]. It is homologous to miR-133a (MI0000159 and MI0000820). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr1: 20682769-20682887 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-133b
mmu-mir-206chr1: 20679010-20679082 [+]
mmu-mir-133bchr1: 20682769-20682887 [+]
Database links

Mature sequence mmu-miR-133b-5p

Accession MIMAT0017083
Previous IDsmmu-miR-133b*
Sequence

29 - 

gcuggucaaacggaaccaaguc

 - 50

Get sequence
Deep sequencing650 reads, 23 experiments
Evidence experimental; Illumina [5]
Predicted targets

Mature sequence mmu-miR-133b-3p

Accession MIMAT0000769
Previous IDsmmu-miR-133b
Sequence

66 - 

uuugguccccuucaaccagcua

 - 87

Get sequence
Deep sequencing97790 reads, 49 experiments
Evidence experimental; cloned [2-3], Illumina [4-5]
Validated targets
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).