WARNING: This summary was generated by AI. MIR133B is a microRNA implicated in various biological processes and has been observed to interact with other RNA molecules and to play a role in disease contexts [PMC7068214]. Specifically, lncRNA LOC400043 has been found to interact with MIR133B, leading to the downregulation of its expression [PMC7068214]. This microRNA has also been utilized in research as a means to attenuate infection by inserting its target sites into the genome of the influenza A virus, demonstrating effective attenuation in murine myocyte-like cells and cardiac tissue [PMC9094651]. Beyond its application in virology, MIR133B has been profiled by researchers studying Parkinson's disease (PD), indicating its potential relevance in the pathology of neurodegenerative diseases [PMC3540391]. The therapeutic potential of MIR133B has been explored through intranasal (IN) delivery, which was assessed for its impact on functional recovery post-spinal cord injury (SCI) using two behavioral tasks: GSM for forelimb grip strength evaluation and a hanging task for forelimb grasp assessment during an 8-week testing time post-SCI [PMC10047048].
----ccucagaagaaaga -- c ca c a u g c
ugcc cccugcu uggcuggu aa gg accaag cc ucuu
|||| ||||||| |||||||| || || |||||| || |||| c
acgg gggacga AUCGACCA UU CC UGGUUU gg agag
agagguuccugacccgua uc c AC C C - - u
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000770 |
| Description | Homo sapiens hsa-miR-133b mature miRNA |
| Sequence | 66 - UUUGGUCCCCUUCAACCAGCUA - 87 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|