Stem-loop sequence hsa-mir-325

AccessionMI0000824 (change log)
Symbol HGNC:MIR325
DescriptionHomo sapiens miR-325 stem-loop
Gene family MIPF0000147; mir-325
Literature search

12 open access papers mention hsa-mir-325
(29 sentences)

Stem-loop 
   ----------a              cc   u    g c      gu uu gug 
5'            uacagugcuugguu  uag aggu u caguaa  g  u   a
              ||||||||||||||  ||| |||| | ||||||  |  |    
3'            gugucacgaacuaa  auc ucca g guuauu  u  a   c
   ggucucggauc              cu   c    g a      ug uu aua
Get sequence
Deep sequencing
22 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted human homologue [2] of a sequence cloned from rat neuronal tissue [1]. The mature miRNA differs from the rat sequence at two positions, and its expression has not been verified in human.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 77005404-77005501 [-]
sense
OTTHUMT00000058860 ; ATRX-001; intron 1
OTTHUMT00000058861 ; ATRX-002; intron 1
OTTHUMT00000058862 ; ATRX-003; intron 1
ENST00000373344 ; ATRX-001; intron 1
ENST00000395603 ; ATRX-002; intron 1
ENST00000480283 ; ATRX-003; intron 1
Database links

Mature sequence hsa-miR-325

Accession MIMAT0000771
Sequence

16 -  

ccuaguagguguccaguaagugu

 - 38

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0000596
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).