miRBase entry: rno-let-7e

Stem-loop rno-let-7e


Accession
MI0000832
Description
Rattus norvegicus rno-let-7e precursor miRNA

Literature search
210 open access papers mention rno-let-7e
(835 sentences)

Sequence

663640 reads, 626.0 reads per million, 506 experiments
cgcgccccccgggcUGAGGUAGGAGGUUGUAUAGUUGaggaagacacccgaggagaucaCUAUACGGCCUCCUAGCUUUCCccaggcugcgcc
.((((..((.(((..(((.((((((((((((((((.((..................)))))))))))))))))).)))..))).))..)))).

Structure
c    cc  c   cU   G                U  ggaagaca 
 gcgc  cc ggg  GAG UAGGAGGUUGUAUAGU Ga        c
 ||||  || |||  ||| |||||||||||||||| ||         
 cgcg  gg ccC  UUC AUCCUCCGGCAUAUCa cu        c
c    uc  a   CU   G                -  agaggagc 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr1: 59704381-59704473 [+]
Clustered miRNAs
3 other miRNAs are < 10 kb from rno-let-7e
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-let-7e-5p

Accession MIMAT0000777
Description Rattus norvegicus rno-let-7e-5p mature miRNA
Sequence 15 - UGAGGUAGGAGGUUGUAUAGUUG - 37
Evidence experimental
cloned [1-3], SOLiD [4]

Mature rno-let-7e-3p

Accession MIMAT0004706
Description Rattus norvegicus rno-let-7e-3p mature miRNA
Sequence 60 - CUAUACGGCCUCCUAGCUUUCC - 81
Evidence experimental
cloned [3], SOLiD [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249