Stem-loop sequence rno-let-7i

Accession

MI0000835 (change log)

Description

Rattus norvegicus let-7i stem-loop

Gene family

MIPF0000002; let-7

Literature search

107 open access papers mention rno-let-7i
(575 sentences)

Stem-loop

        u                 u   --------  u     ugu 
5' cuggc gagguaguaguuugugc guu        gg cgggu   g
   ||||| ||||||||||||||||| |||        || |||||   a
3' gaucg uuccgucaucgaacgcg caa        uc gcccg   c
        -                 u   uagaggug  -     uua 

Deep sequencing

7610579 reads, 6.61e+03 reads per million, 512 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr7: 66802731-66802815 [+]
• Overlapping transcripts:

  sense

  ENSRNOT00000053765 ; Mirlet7i-201; exon 1

Database links

• EntrezGene:Mirlet7i
• miRBase Tracker:MI0000835

Mature sequence rno-let-7i-5p

• Accession: MIMAT0000779
• Previous IDs: rno-let-7i
• Sequence: 6 - ugagguaguaguuugugcuguu - 27
• Deep sequencing: 7593666 reads, 512 experiments
• Evidence: experimental; cloned [1-5], SOLiD [6]
• Predicted targets:
  • TargetScanVert:rno-let-7i-5p
  • miRDB:rno-let-7i-5p
  • microrna.org:rno-let-7i-5p

Mature sequence rno-let-7i-3p

• Accession: MIMAT0004707
• Previous IDs: rno-let-7i*
• Sequence: 62 - cugcgcaagcuacugccuugcu - 83
• Deep sequencing: 16863 reads, 479 experiments
• Evidence: experimental; cloned [4], SOLiD [6]
• Predicted targets:
  • TargetScanVert:rno-let-7i-3p
  • miRDB:rno-let-7i-3p
  • microrna.org:rno-let-7i-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
6. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).