![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-19b-1 |
||||||||||||||
Accession | MI0000847 (change log) | |||||||||||||
Description | Rattus norvegicus miR-19b-1 stem-loop | |||||||||||||
Gene family | MIPF0000011; mir-19 | |||||||||||||
Literature search |
![]()
45 open access papers mention rno-mir-19b-1 | |||||||||||||
Stem-loop |
ggu - - uc uguau 5' cacu cuaugguuaguuuugca gg uuugca cagc a |||| ||||||||||||||||| || |||||| |||| a 3' gugg ggugucagucaaaacgu cc aaacgu gucg u --u a u -- ucuua |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
Mature sequence rno-miR-19b-1-5p |
|
Accession | MIMAT0017096 |
Previous IDs | rno-miR-19b-1* |
Sequence |
16 - aguuuugcagguuugcauccag - 37 |
Deep sequencing | 131 reads, 93 experiments |
Evidence | experimental; SOLiD [4] |
Predicted targets |
|
Mature sequence rno-miR-19b-3p |
|
Accession | MIMAT0000788 |
Previous IDs | rno-miR-19b |
Sequence |
54 - ugugcaaauccaugcaaaacuga - 76 |
Deep sequencing | 310991 reads, 499 experiments |
Evidence | experimental; cloned [1-3], SOLiD [4] |
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|