Stem-loop sequence rno-mir-23b

AccessionMI0000853 (change log)
DescriptionRattus norvegicus miR-23b stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
   cuca  -u c  -   c   u   --          -  c      gugacu 
5'     cc  g uc ugg ugc ugg  guuccuggca ug ugauuu      u
       ||  | || ||| ||| |||  |||||||||| || ||||||       
3'     gg  c ag acc acg acc  uagggaccgu ac acuaaa      g
   ---c  uu c  u   a   c   au          u  -      auuaga 
Get sequence
Deep sequencing
109677 reads, 1.36e+03 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr17: 823222-823318 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-23b
rno-mir-23bchr17: 823222-823318 [+]
rno-mir-27bchr17: 823461-823557 [+]
rno-mir-3074chr17: 823940-824056 [-]
rno-mir-24-1chr17: 823968-824035 [+]
Database links

Mature sequence rno-miR-23b-5p

Accession MIMAT0017099
Previous IDsrno-miR-23b*
Sequence

21 - 

ggguuccuggcaugcugauuu

 - 41

Get sequence
Deep sequencing23 reads, 13 experiments
Evidence experimental; SOLiD [4]
Predicted targets

Mature sequence rno-miR-23b-3p

Accession MIMAT0000793
Previous IDsrno-miR-23b
Sequence

58 - 

aucacauugccagggauuacc

 - 78

Get sequence
Deep sequencing109633 reads, 39 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).