![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-24-2 |
||||||||
Accession | MI0000855 (change log) | |||||||
Description | Rattus norvegicus miR-24-2 stem-loop | |||||||
Gene family | MIPF0000041; mir-24 | |||||||
Literature search |
![]()
39 open access papers mention rno-mir-24-2 | |||||||
Stem-loop |
- -u ---cu ccgc g a aa ug u 5' gcc cucc gggcu cuccugu ccu cugagcuga cagu au c ||| |||| ||||| ||||||| ||| ||||||||| |||| || 3' cgg gagg cccga gaggaca gga gacuugacu guca ug c a uc auacc -ccu a c cg cg a |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
Mature sequence rno-miR-24-2-5p |
|
Accession | MIMAT0005441 |
Previous IDs | rno-miR-24-2* |
Sequence |
25 - gugccuacugagcugaaacagu - 46 |
Deep sequencing | 151634 reads, 490 experiments |
Evidence | experimental; cloned [3], SOLiD [5] |
Predicted targets |
|
Mature sequence rno-miR-24-3p |
|
Accession | MIMAT0000794 |
Previous IDs | rno-miR-24 |
Sequence |
61 - uggcucaguucagcaggaacag - 82 |
Deep sequencing | 1146242 reads, 492 experiments |
Evidence | experimental; cloned [1-4], Northern [2], SOLiD [5] |
Predicted targets |
|
References |
|
1 |
PMID:15345052
"Microarray analysis of microRNA expression in the developing mammalian brain"
Genome Biol. 5:R68(2004).
|
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:17805466
"Cloning and identification of novel microRNAs from rat hippocampus"
Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
|
5 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|