Stem-loop sequence rno-mir-26a

Accession

MI0000857 (change log)

Description

Rattus norvegicus miR-26a stem-loop

Gene family

MIPF0000043; mir-26

Literature search

54 open access papers mention rno-mir-26a
(454 sentences)

Stem-loop

   a     -   g      u         c          g gca g 
5'  aggcc gug ccuugu caaguaauc aggauaggcu u   g u
    ||||| ||| |||||| ||||||||| |||||||||| |   |  
3'  uccgg cgc ggggca guucauugg ucuuauccgg g   c c
   g     g   a      c         u          g -aa c 

Deep sequencing

46206412 reads, 3.72e+04 reads per million, 514 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr8: 127714441-127714530 [+]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:Mir26a
• miRBase Tracker:MI0000857

Mature sequence rno-miR-26a-5p

• Accession: MIMAT0000796
• Previous IDs: rno-miR-26a
• Sequence: 16 - uucaaguaauccaggauaggcu - 37
• Deep sequencing: 46205665 reads, 514 experiments
• Evidence: experimental; cloned [1-3], SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-26a-5p
  • miRDB:rno-miR-26a-5p
  • microrna.org:rno-miR-26a-5p

Mature sequence rno-miR-26a-3p

• Accession: MIMAT0017100
• Previous IDs: rno-miR-26a*
• Sequence: 55 - ccuauucuugguuacuugcac - 75
• Deep sequencing: 730 reads, 259 experiments
• Evidence: experimental; SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-26a-3p
  • miRDB:rno-miR-26a-3p

References

1. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
4. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).