![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-28 |
|||||
Accession | MI0000861 (change log) | ||||
Description | Rattus norvegicus miR-28 stem-loop | ||||
Gene family | MIPF0000057; mir-28 | ||||
Literature search |
![]()
13 open access papers mention rno-mir-28 | ||||
Stem-loop |
c a gca --uu -u cu 5' ggu ccu ccc aggagcucacagucua gag uc u ||| ||| ||| |||||||||||||||| ||| || u 3' uca gga ggg uccucgaguguuagau cuc ag u c c agg cacc uu uc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-28-5p |
|
Accession | MIMAT0000800 |
Previous IDs | rno-miR-28 |
Sequence |
14 - aaggagcucacagucuauugag - 35 |
Deep sequencing | 223542 reads, 499 experiments |
Evidence | experimental; cloned [1-3], SOLiD [4] |
Predicted targets |
|
Mature sequence rno-miR-28-3p |
|
Accession | MIMAT0004716 |
Previous IDs | rno-miR-28* |
Sequence |
54 - cacuagauugugagcuccugga - 75 |
Deep sequencing | 1096508 reads, 506 experiments |
Evidence | experimental; cloned [3], SOLiD [4] |
Predicted targets |
|
References |
|
1 |
PMID:15345052
"Microarray analysis of microRNA expression in the developing mammalian brain"
Genome Biol. 5:R68(2004).
|
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|