Stem-loop sequence rno-mir-30c-2

Accession

MI0000871 (change log)

Description

Rattus norvegicus miR-30c-2 stem-loop

Gene family

MIPF0000005; mir-30

Literature search

62 open access papers mention rno-mir-30c-2
(510 sentences)

Stem-loop

      u a    uacu       u   aca         gugaaa 
5' gag g caga    guaaaca ccu   cucucagcu      a
   ||| | ||||    ||||||| |||   |||||||||       
3' uuc c gucu    cauuugu gga   gagggucga      g
      - -    cucu       c   --a         aagaau 

Deep sequencing

6045107 reads, 4.22e+03 reads per million, 511 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr9: 29562376-29562459 [+]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:Mir30c-2
• miRBase Tracker:MI0000871

Mature sequence rno-miR-30c-5p

• Accession: MIMAT0000804
• Previous IDs: rno-miR-30c
• Sequence: 14 - uguaaacauccuacacucucagc - 36
• Deep sequencing: 11978233 reads, 511 experiments
• Evidence: experimental; cloned [1-5], SOLiD [6]
• Predicted targets:
  • TargetScanVert:rno-miR-30c-5p
  • miRDB:rno-miR-30c-5p
  • microrna.org:rno-miR-30c-5p

Mature sequence rno-miR-30c-2-3p

• Accession: MIMAT0005442
• Previous IDs: rno-miR-30c-2*
• Sequence: 54 - cugggagaaggcuguuuacucu - 75
• Deep sequencing: 56128 reads, 498 experiments
• Evidence: experimental; cloned [4], SOLiD [6]
• Predicted targets:
  • TargetScanVert:rno-miR-30c-2-3p
  • miRDB:rno-miR-30c-2-3p
  • microrna.org:rno-miR-30c-2-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
6. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).