Stem-loop sequence rno-mir-34c

Accession MI0000876
Description Rattus norvegicus miR-34c stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network of proteins; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     ag     a   a    a     c      c  a 
agucu  uuacu ggc gugu guuag ugauug ua u
|||||  ||||| ||| |||| ||||| |||||| ||  
ucaga  aaugg ccg caca caauc acuaac au a
     aa     a   a    c     -      c  g 
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
8: 54422052-54422128 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-34c
rno-mir-34b 8: 54422570-54422653 [-]
rno-mir-34c 8: 54422052-54422128 [-]
Database links

Mature sequence rno-miR-34c-5p

Accession MIMAT0000814
Previous IDs rno-miR-34c
Sequence

13 - 

aggcaguguaguuagcugauugc

 - 35

Get sequence
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-34c-3p

Accession MIMAT0004723
Previous IDs rno-miR-34c*
Sequence

46 - 

aaucacuaaccacacagccagg

 - 67

Get sequence
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).