![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-98 |
||||||
Accession | MI0000882 (change log) | |||||
Description | Rattus norvegicus miR-98 stem-loop | |||||
Gene family | MIPF0000002; let-7 | |||||
Literature search |
![]()
35 open access papers mention rno-mir-98 | |||||
Stem-loop |
c - ug u u --------- aggg 5' ugc acaugc ggg gagguaguaaguuguau guug uggggu a ||| |||||| ||| ||||||||||||||||| |||| |||||| u 3' acg ugugug ccc uuucaucauucaacaua caau accccg u u g gu - u agaagaaua gauu |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence rno-miR-98-5p |
|
Accession | MIMAT0000819 |
Previous IDs | rno-miR-98 |
Sequence |
16 - ugagguaguaaguuguauuguu - 37 |
Deep sequencing | 8395697 reads, 514 experiments |
Evidence | experimental; cloned [1-3], SOLiD [4] |
Predicted targets |
|
Mature sequence rno-miR-98-3p |
|
Accession | MIMAT0017111 |
Previous IDs | rno-miR-98* |
Sequence |
74 - cuauacaacuuacuacuuucc - 94 |
Deep sequencing | 17587 reads, 474 experiments |
Evidence | experimental; SOLiD [4] |
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|