Stem-loop sequence rno-mir-101a

AccessionMI0000886 (change log)
Previous IDsrno-mir-101
DescriptionRattus norvegicus miR-101a stem-loop
Gene family MIPF0000046; mir-101
Literature search

23 open access papers mention rno-mir-101a
(181 sentences)

Stem-loop 
   u   cuggc                  a    gucca 
5'  gcc     ucaguuaucacagugcug ugcu     u
    |||     |||||||||||||||||| ||||      
3'  cgg     agucaauagugucaugac augg     u
   a   uagga                  -    aaauc
Get sequence
Deep sequencing
4502113 reads, 3.81e+03 reads per million, 514 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr5: 120168437-120168511 [-]
sense
ENSRNOT00000053722 ; Mir101a-201; exon 1
Database links

Mature sequence rno-miR-101a-5p

Accession MIMAT0004726
Previous IDsrno-miR-101a*
Sequence

10 -  

ucaguuaucacagugcugaugc

 - 31

Get sequence
Deep sequencing11435 reads, 467 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-101a-3p

Accession MIMAT0000823
Previous IDsrno-miR-101;rno-miR-101a
Sequence

47 -  

uacaguacugugauaacugaa

 - 67

Get sequence
Deep sequencing4490657 reads, 514 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

References

1
PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).