![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-127 |
||||||||||||||||||||||||||
Accession | MI0000899 (change log) | |||||||||||||||||||||||||
Description | Rattus norvegicus miR-127 stem-loop | |||||||||||||||||||||||||
Gene family | MIPF0000080; mir-127 | |||||||||||||||||||||||||
Literature search |
![]()
26 open access papers mention rno-mir-127 | |||||||||||||||||||||||||
Stem-loop |
-----uuu ca ucu ugcug g c -- a 5' gau cug ccagcc aagcucaga gg ucugau uc g ||| ||| |||||| ||||||||| || |||||| || a 3' cug ggc ggucgg uucgagucu cc aggcua ag a cuacuacu aa --u ----- g u cu a |
|||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||
Database links |
Mature sequence rno-miR-127-5p |
|
Accession | MIMAT0017117 |
Previous IDs | rno-miR-127* |
Sequence |
23 - cugaagcucagagggcucugauu - 45 |
Deep sequencing | 76424 reads, 367 experiments |
Evidence | experimental; SOLiD [4] |
Predicted targets |
|
Mature sequence rno-miR-127-3p |
|
Accession | MIMAT0000833 |
Previous IDs | rno-miR-127 |
Sequence |
57 - ucggauccgucugagcuuggcu - 78 |
Deep sequencing | 34420442 reads, 493 experiments |
Evidence | experimental; cloned [1-3], SOLiD [4] |
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:15345052
"Microarray analysis of microRNA expression in the developing mammalian brain"
Genome Biol. 5:R68(2004).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|