Stem-loop sequence rno-mir-128-1

Accession MI0000900
Previous IDs rno-mir-128a
Description Rattus norvegicus miR-128-1 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop 
u    u      uuc       uag      cu       u 
 gagc guugga   ggggccg   cacugu  gagaggu u
 |||| ||||||   |||||||   ||||||  |||||||  
 uucg cgacuu   cucuggc   gugaca  cucuuua a
c    u      uuu       caa      --       c
Get sequence
Comments

The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2.

Genome context
Coordinates (RGSC3.4) Overlapping transcripts
13: 40907575-40907656 [+]
sense
ENSRNOT00000061250 ; F1M9A8_RAT; intron 17
ENSRNOT00000061250 ; F1M9A8_RAT; intron 17
ENSRNOT00000061250 ; F1M9A8_RAT; intron 17
ENSRNOT00000005372 ; R3hdm1; intron 19
ENSRNOT00000065514 ; F1LNP0_RAT; intron 19
ENSRNOT00000005372 ; R3hdm1; intron 19
ENSRNOT00000065514 ; F1LNP0_RAT; intron 19
ENSRNOT00000005372 ; R3hdm1; intron 19
ENSRNOT00000065514 ; F1LNP0_RAT; intron 19
Database links

Mature sequence rno-miR-128-1-5p

Accession MIMAT0017118
Previous IDs rno-miR-128-1*
Sequence

15 -  

cggggccguagcacugucuga

 - 35

Get sequence
Evidence experimental; SOLiD [3]
Predicted targets

Mature sequence rno-miR-128-3p

Accession MIMAT0000834
Previous IDs rno-miR-128a;rno-miR-128
Sequence

50 -  

ucacagugaaccggucucuuu

 - 70

Get sequence
Evidence experimental; cloned [1-2], SOLiD [3]

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).