Stem-loop sequence rno-mir-128-1

AccessionMI0000900
Previous IDsrno-mir-128a
DescriptionRattus norvegicus miR-128-1 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   u    u      uuc       uag      cu       u 
5'  gagc guugga   ggggccg   cacugu  gagaggu u
    |||| ||||||   |||||||   ||||||  |||||||  
3'  uucg cgacuu   cucuggc   gugaca  cucuuua a
   c    u      uuu       caa      --       c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Comments

The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2.

Genome context
Coordinates (Rnor_5.0) Overlapping transcripts
chr13: 50001706-50001787 [+]
sense
ENSRNOT00000005372 ; R3hdm1-201; intron 19
Database links

Mature sequence rno-miR-128-1-5p

Accession MIMAT0017118
Previous IDsrno-miR-128-1*
Sequence

15 - 

cggggccguagcacugucuga

 - 35

Get sequence
Evidence experimental; SOLiD [3]
Predicted targets

Mature sequence rno-miR-128-3p

Accession MIMAT0000834
Previous IDsrno-miR-128a;rno-miR-128
Sequence

50 - 

ucacagugaaccggucucuuu

 - 70

Get sequence
Evidence experimental; cloned [1-4], Northern [1], SOLiD [5]
Validated targets
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).