![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-133a |
||||||||||
Accession | MI0000906 (change log) | |||||||||
Description | Rattus norvegicus miR-133a stem-loop | |||||||||
Gene family | MIPF0000029; mir-133 | |||||||||
Literature search |
![]()
98 open access papers mention rno-mir-133a | |||||||||
Stem-loop |
- uuu a aa u a gccuc 5' caaugc gcua agcuggu aa gg accaaauc u |||||| |||| ||||||| || || |||||||| 3' guuacg cgau ucgacca uu cc ugguuuag u a uau g ac c c guaac |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: high
| |||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
Mature sequence rno-miR-133a-5p |
|
Accession | MIMAT0017124 |
Previous IDs | rno-miR-133a* |
Sequence |
15 - agcugguaaaauggaaccaaau - 36 |
Deep sequencing | 45020 reads, 239 experiments |
Evidence | experimental; SOLiD [2] |
Predicted targets |
|
Mature sequence rno-miR-133a-3p |
|
Accession | MIMAT0000839 |
Previous IDs | rno-miR-133a |
Sequence |
52 - uuugguccccuucaaccagcug - 73 |
Deep sequencing | 34794668 reads, 491 experiments |
Evidence | experimental; cloned [1], SOLiD [2] |
Predicted targets |
|
References |
|
1 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|