Stem-loop sequence rno-mir-138-2

Accession

MI0000911 (change log)

Description

Rattus norvegicus miR-138-2 stem-loop

Gene family

MIPF0000075; mir-138

Literature search

41 open access papers mention rno-mir-138-2
(176 sentences)

Stem-loop

   gu   u  ag             uca     ---ac   caa 
5'   ugc gc  cugguguugugaa   ggccg     gag   c
     ||| ||  |||||||||||||   |||||     |||   g
3'   acg ug  gaccacagcacuu   ucggc     cuc   c
   cc   u  -g             -ua     ccauu   cua 

Deep sequencing

1608630 reads, 1.17e+03 reads per million, 493 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr19: 11149748-11149829 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:Mir138-2
• miRBase Tracker:MI0000911

Mature sequence rno-miR-138-5p

• Accession: MIMAT0000844
• Previous IDs: rno-miR-138
• Sequence: 9 - agcugguguugugaaucaggccg - 31
• Deep sequencing: 3216645 reads, 493 experiments
• Evidence: experimental; cloned [1-4], Northern [1], SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-miR-138-5p
  • miRDB:rno-miR-138-5p
  • microrna.org:rno-miR-138-5p

Mature sequence rno-miR-138-2-3p

• Accession: MIMAT0017127
• Previous IDs: rno-miR-138-2*
• Sequence: 56 - gcuauuucacgacaccagggu - 76
• Deep sequencing: 1998 reads, 154 experiments
• Evidence: experimental; SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-miR-138-2-3p
  • miRDB:rno-miR-138-2-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).