Stem-loop sequence rno-mir-142

AccessionMI0000915 (change log)
DescriptionRattus norvegicus miR-142 stem-loop
Gene family MIPF0000084; mir-142
Literature search

36 open access papers mention rno-mir-142
(218 sentences)

Stem-loop
   g        g   c           a         uaa ag a 
5'  acagugca uca ccauaaaguag aagcacuac   c  c c
    |||||||| ||| ||||||||||| |||||||||   |  |  
3'  ugucaugu agu gguauuucauc uuugugaug   g  g u
   g        g   a           c         -ug ga g 
Get sequence
Deep sequencing
906929 reads, 1.15e+03 reads per million, 495 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 75050839-75050925 [+]
sense
ENSRNOT00000053756 ; Mir142-201; exon 1
Database links

Mature sequence rno-miR-142-5p

Accession MIMAT0000847
Sequence

16 - 

cauaaaguagaaagcacuacu

 - 36

Get sequence
Deep sequencing817274 reads, 495 experiments
Evidence experimental; cloned [2-3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-142-3p

Accession MIMAT0000848
Sequence

52 - 

uguaguguuuccuacuuuaugga

 - 74

Get sequence
Deep sequencing89643 reads, 488 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).