Stem-loop sequence rno-mir-185

Accession

MI0000930 (change log)

Description

Rattus norvegicus miR-185 stem-loop

Gene family

MIPF0000202; mir-185

Literature search

14 open access papers mention rno-mir-185
(174 sentences)

Stem-loop

   -     u       ug   a     g         au  uc 
5'  ggggg gagggau  gag gaaag caguuccug  gg  c
    ||||| |||||||  ||| ||||| |||||||||  ||   
3'  cccuc cuuccug  cuc cuuuc gucggggac  cc  c
   a     u       gu   -     g         --  uc 

Deep sequencing

48564 reads, 8.59 reads per million, 489 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr11: 86812702-86812781 [+]
• Overlapping transcripts:

  sense

  ENSRNOT00000046594 ; Tango2-201; intron 1

Database links

• EntrezGene:Mir185
• miRBase Tracker:MI0000930

Mature sequence rno-miR-185-5p

• Accession: MIMAT0000862
• Previous IDs: rno-miR-185
• Sequence: 14 - uggagagaaaggcaguuccuga - 35
• Deep sequencing: 42543 reads, 486 experiments
• Evidence: experimental; cloned [1-3], SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-185-5p
  • miRDB:rno-miR-185-5p
  • microrna.org:rno-miR-185-5p

Mature sequence rno-miR-185-3p

• Accession: MIMAT0017142
• Previous IDs: rno-miR-185*
• Sequence: 58 - uuuccucugguccuucucu - 76
• Deep sequencing: 5049 reads, 376 experiments
• Evidence: experimental; SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-185-3p
  • miRDB:rno-miR-185-3p

References

1. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).