![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-185 |
|||||
Accession | MI0000930 (change log) | ||||
Description | Rattus norvegicus miR-185 stem-loop | ||||
Gene family | MIPF0000202; mir-185 | ||||
Literature search |
![]()
14 open access papers mention rno-mir-185 | ||||
Stem-loop |
- u ug a g au uc 5' ggggg gagggau gag gaaag caguuccug gg c ||||| ||||||| ||| ||||| ||||||||| || 3' cccuc cuuccug cuc cuuuc gucggggac cc c a u gu - g -- uc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. |
||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-185-5p |
|
Accession | MIMAT0000862 |
Previous IDs | rno-miR-185 |
Sequence |
14 - uggagagaaaggcaguuccuga - 35 |
Deep sequencing | 42543 reads, 486 experiments |
Evidence | experimental; cloned [1-3], SOLiD [4] |
Predicted targets |
|
Mature sequence rno-miR-185-3p |
|
Accession | MIMAT0017142 |
Previous IDs | rno-miR-185* |
Sequence |
58 - uuuccucugguccuucucu - 76 |
Deep sequencing | 5049 reads, 376 experiments |
Evidence | experimental; SOLiD [4] |
Predicted targets |
|
References |
|
1 |
PMID:15345052
"Microarray analysis of microRNA expression in the developing mammalian brain"
Genome Biol. 5:R68(2004).
|
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|