Stem-loop sequence rno-mir-211

AccessionMI0000951
DescriptionRattus norvegicus miR-211 stem-loop
Gene family MIPF0000042; mir-204
Stem-loop
   -ca  -u    ccu      u                ca     u    ag  cu 
5'    gc  ugga   gugacc cugggcuucccuuugu  uccuu gccu  gc  c
      ||  ||||   |||||| ||||||||||||||||  ||||| ||||  ||   
3'    cg  aucu   cacugg gacucggggggaaacg  aggaa cggg  ug  u
   aga  uc    --c      u                ac     -    -g  ag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_5.0) Overlapping transcripts
chr1: 126151169-126151274 [+]
sense
ENSRNOT00000065343 ; Trpm1-201; intron 6
ENSRNOT00000021262 ; Trpm1-202; intron 6
Database links

Mature sequence rno-miR-211-5p

Accession MIMAT0000882
Previous IDsrno-miR-211
Sequence

26 - 

uucccuuugucauccuuugccu

 - 47

Get sequence
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-211-3p

Accession MIMAT0017157
Previous IDsrno-miR-211*
Sequence

62 - 

ggcaaggacagcaaaggggg

 - 81

Get sequence
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).