Stem-loop sequence rno-mir-217

AccessionMI0000956 (change log)
DescriptionRattus norvegicus miR-217 stem-loop
Gene family MIPF0000077; mir-217
Stem-loop
   accacagucauugua    u     c c  a  c     c         c   auaa     
5'                guuu gaugu g ag ua ugcau aggaacuga ugg    gacu 
                  |||| ||||| | || || ||||| ||||||||| |||    ||| c
3'                caaa cuacg c uc gu acgua uccuugacu acc    cuga 
   --------------a    u     a u  c  u     a         -   ---a     
Get sequence
Deep sequencing
51575 reads, 776 reads per million, 29 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr14: 113119529-113119633 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-217
rno-mir-216achr14: 113112129-113112234 [+]
rno-mir-217chr14: 113119529-113119633 [+]
Database links

Mature sequence rno-miR-217-5p

Accession MIMAT0000887
Previous IDsrno-miR-217
Sequence

32 - 

uacugcaucaggaacugacugg

 - 53

Get sequence
Deep sequencing50431 reads, 29 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-217-3p

Accession MIMAT0017161
Previous IDsrno-miR-217*
Sequence

70 - 

aucaguuccuaaugcauugccu

 - 91

Get sequence
Deep sequencing1126 reads, 12 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).