![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-300 |
||||||||||||||||||||||||||||||||||||||
Accession | MI0000971 (change log) | |||||||||||||||||||||||||||||||||||||
Description | Rattus norvegicus miR-300 stem-loop | |||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000018; mir-154 | |||||||||||||||||||||||||||||||||||||
Literature search |
![]()
7 open access papers mention rno-mir-300 | |||||||||||||||||||||||||||||||||||||
Stem-loop |
a g au gc a 5' gcu cuugaagagag uu ccuuuguguguuu uuu c ||| ||||||||||| || ||||||||||||| ||| 3' cga gagcuucucuc aa gggaacguauaag aag g g g -c ua c |
|||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||
Database links |
Mature sequence rno-miR-300-5p |
|
Accession | MIMAT0004743 |
Sequence |
6 - uugaagagagguuauccuuugu - 27 |
Deep sequencing | 889 reads, 124 experiments |
Evidence | experimental; cloned [2-3], SOLiD [4] |
Predicted targets |
|
Mature sequence rno-miR-300-3p |
|
Accession | MIMAT0000902 |
Previous IDs | rno-miR-300 |
Sequence |
51 - uaugcaagggcaagcucucuuc - 72 |
Deep sequencing | 370842 reads, 463 experiments |
Evidence | experimental; cloned [1-3], SOLiD [4] |
Predicted targets |
|
References |
|
1 |
PMID:15345052
"Microarray analysis of microRNA expression in the developing mammalian brain"
Genome Biol. 5:R68(2004).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:17805466
"Cloning and identification of novel microRNAs from rat hippocampus"
Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
|
4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|