Stem-loop sequence mmu-mir-215

AccessionMI0000974
Symbol MGI:Mir215
DescriptionMus musculus miR-215 stem-loop
Gene family MIPF0000063; mir-192
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-192/215_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-192 microRNA precursor (homologous to miR-215), is a short non-coding RNA gene involved in gene regulation. miR-192 and miR-215 have now been predicted or experimentally confirmed in mouse and human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-192 and mir-215 are thought to be positive regulators of p53, a human tumour suppressor. They are also overexpressed in gastric cancer, and could potentially be used as biomarkers or therapeutic targets. It has also been suggested that mir-192 could be used as a biomarker for drug-induced liver damage.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   agcucuc    ucaac  ug       gaa  a     -  uu        c     g 
5'        agca     gg  uacagga   ug ccuau ga  ugacagac gugca c
          ||||     ||  |||||||   || ||||| ||  |||||||| |||||  
3'        ucgu     cu  augucuu   ac ggaug cu  acugucug uaugu u
   aaauuca    ---ca  gu       aua  c     u  -u        -     g 
Get sequence
Deep sequencing
213362 reads, 1.72e+03 reads per million, 103 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This mouse miRNA was predicted by computational methods using conservation with human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. The 3' end was not experimentally determined. The mature sequence differs from the human miR-215 at A12->U, and its expression has not been verified in mouse.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr1: 185313581-185313692 [+]
antisense
OTTMUST00000051852 ; Iars2-001; intron 12
OTTMUST00000051855 ; Iars2-004; intron 12
OTTMUST00000051856 ; Iars2-005; intron 12
ENSMUST00000027921 ; Iars2-001; intron 12
ENSMUST00000110975 ; Iars2-005; intron 12
ENSMUST00000110974 ; Iars2-004; intron 12
Clustered miRNAs
< 10kb from mmu-mir-215
mmu-mir-194-1chr1: 185313319-185313385 [+]
mmu-mir-215chr1: 185313581-185313692 [+]
Database links

Mature sequence mmu-miR-215-5p

Accession MIMAT0000904
Previous IDsmmu-miR-215
Sequence

30 - 

augaccuaugauuugacagac

 - 50

Get sequence
Deep sequencing175935 reads, 74 experiments
Evidence experimental; Illumina [2-3]
Validated targets
Predicted targets

Mature sequence mmu-miR-215-3p

Accession MIMAT0017169
Previous IDsmmu-miR-215*
Sequence

67 - 

ucugucauucuguaggccaau

 - 87

Get sequence
Deep sequencing331 reads, 17 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).