Stem-loop sequence ath-MIR169d

AccessionMI0000978 (change log)
DescriptionArabidopsis thaliana miR169d stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

34 open access papers mention ath-MIR169d
(160 sentences)

Stem-loop 
        a      c   -   g     auu      u     u         a          augu      ca    uu 
5' guauc uagagu uug cau gaaaa   aaagaa gagau gagccaagg ugacuugccg    uaucaa  aauc  a
   ||||| |||||| ||| ||| |||||   |||||| ||||| ||||||||| ||||||||||    ||||||  ||||   
3' uauag aucuca aac gua cuuuu   uuucuu cuuug cucgguucc guugaacggc    gugguu  uuag  a
        -      -   u   a     -cu      c     u         a          --cu      --    uc
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1], later experimentally verified [2]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 20039463-20039616 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR169d
ath-MIR169echr1: 20041518-20041734 [+]
ath-MIR169dchr1: 20039463-20039616 [-]
Database links

Mature sequence ath-miR169d

Accession MIMAT0000908
Sequence

41 -  

ugagccaaggaugacuugccg

 - 61

Get sequence
Evidence experimental; cloned [2], 454 [3-4], MPSS [3], Illumina [5]

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).