![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR169g |
|||||
Accession | MI0000981 (change log) | ||||
Description | Arabidopsis thaliana miR169g stem-loop | ||||
Gene family | MIPF0000037; MIR169_2 | ||||
Literature search |
![]()
35 open access papers mention ath-MIR169g | ||||
Stem-loop |
-ugccuauaaauaccuucaucacgaguaugacaagaucac a -agaaaggu - ga ------------ ---- g ucucuaguu aga u -- au u uu a uuuuuu au uaa 5' aag caagaaa agagaaa acau uaauga ugauuacga ugauga ag guauc gggucu gcau ggaaga agagaa gagg gagccaagg ugacuugccggg uacca gaauc u ||| ||||||| ||||||| |||| |||||| ||||||||| |||||| || ||||| |||||| |||| |||||| |||||| |||| ||||||||| |||||||||||| ||||| ||||| u 3' uuc guuuuuu ucuuuuu ugua guuacu acuagugcu acuacu uc uauag cucaga ugua uuuucu ucucuu cuuu cucgguucc guugaacggccu guggu cuuag a acguuuuuguuuuuagacuaguaaguuuagcuuuuuggca g aagcguagu g aa uuaauguuucaa aagu a --------- aac c gg -- c gu a ------ -- uca |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence is a predicted paralogue of the previously identified miR169 family [1], later experimentally verified [3,4]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors. Wang et al. report Northern blot evidence for the miR169* sequence from the opposite arm of the precursor [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR169g-5p |
|
Accession | MIMAT0000911 |
Previous IDs | ath-miR169g |
Sequence |
144 - ugagccaaggaugacuugccg - 164 |
Evidence | experimental; cloned [3], 454 [4-5], MPSS [4], Illumina [6] |
Mature sequence ath-miR169g-3p |
|
Accession | MIMAT0000912 |
Previous IDs | ath-miR169g* |
Sequence |
204 - uccggcaaguugaccuuggcu - 224 |
Evidence | experimental; Northern [2], 454 [5] |
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 |
PMID:15345049
"Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets"
Genome Biol. 5:R65(2004).
|
3 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
4 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
5 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
6 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|