![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR393a |
|||||
Accession | MI0001003 (change log) | ||||
Description | Arabidopsis thaliana miR393a stem-loop | ||||
Gene family | MIPF0000083; MIR393 | ||||
Literature search |
![]()
32 open access papers mention ath-MIR393a | ||||
Stem-loop |
a a c u -u aggugaauucuccccauauuuucuuua 5' gagga ggauccaaagggau gcau gaucc aauua u ||||| |||||||||||||| |||| ||||| ||||| a 3' uuccu cuuagguuucucua cgua cuagg uuggu a c a u - uu ucguuuaaaaacacuaaauaaacgguu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence belongs to the miR393 family of miRNAs, which are predicted to target mRNAs coding for F-box proteins and bHLH transcription factors [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR393a-3p |
|
Accession | MIMAT0031905 |
Sequence |
105 - aucaugcuaucucuuuggauu - 125 |
Evidence | not experimental |
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 |
PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"
Plant Cell. 16:2001-2019(2004).
|
3 |
PMID:15345049
"Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets"
Genome Biol. 5:R65(2004).
|
4 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
5 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|