Stem-loop sequence ath-MIR394a

AccessionMI0001005 (change log)
DescriptionArabidopsis thaliana miR394a stem-loop
Gene family MIPF0000100; MIR394
Literature search

12 open access papers mention ath-MIR394a
(24 sentences)

Stem-loop 
     u    -  a   -      u c gu            -a     -au          a 
5' cu acag uc ucu uuggca u u  ccaccuccuucu  uacau   augcaugugu u
   || |||| || ||| |||||| | |  ||||||||||||  |||||   ||||||||||  
3' ga uguc ag aga aaccgu a a  gguggaggaaga  gugug   ugcguauaua a
     u    u  -   u      c u ug            aa     cuu          u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR394 family of miRNAs, which are predicted to target mRNAs coding for F-box proteins [1].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 7058194-7058310 [+]
intergenic
Database links

Mature sequence ath-miR394a

Accession MIMAT0000936
Sequence

14 -  

uuggcauucuguccaccucc

 - 33

Get sequence
Evidence experimental; 5'RACE [1-2], Northern [1], PCR [1], 454 [3], MPSS [3]

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).