![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR394a |
|||||
Accession | MI0001005 (change log) | ||||
Description | Arabidopsis thaliana miR394a stem-loop | ||||
Gene family | MIPF0000100; MIR394 | ||||
Literature search |
![]()
12 open access papers mention ath-MIR394a | ||||
Stem-loop |
u - a - u c gu -a -au a 5' cu acag uc ucu uuggca u u ccaccuccuucu uacau augcaugugu u || |||| || ||| |||||| | | |||||||||||| ||||| |||||||||| 3' ga uguc ag aga aaccgu a a gguggaggaaga gugug ugcguauaua a u u - u c u ug aa cuu u |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence belongs to the miR394 family of miRNAs, which are predicted to target mRNAs coding for F-box proteins [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR394a |
|
Accession | MIMAT0000936 |
Sequence |
14 - uuggcauucuguccaccucc - 33 |
Evidence | experimental; 5'RACE [1-2], Northern [1], PCR [1], 454 [3], MPSS [3] |
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
3 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
4 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|