Stem-loop sequence ath-MIR395c

AccessionMI0001009 (change log)
DescriptionArabidopsis thaliana miR395c stem-loop
Gene family MIPF0000016; MIR395
Literature search

25 open access papers mention ath-MIR395c
(107 sentences)

Stem-loop 
      uc   -au         uu         u     a    uca     a 
5' aug  cac   gaguucccu  aacgcuuca uguug auac   aagcc c
   |||  |||   |||||||||  ||||||||| ||||| ||||   ||||| a
3' uac  gug   cucaggggg  uugugaagu acaau uaug   uuugg u
      -u   guu         gu         c     a    ---     u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 9367080-9367179 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR395c
ath-MIR395achr1: 9363196-9363288 [-]
ath-MIR395bchr1: 9364471-9364570 [+]
ath-MIR395cchr1: 9367080-9367179 [+]
Database links

Mature sequence ath-miR395c

Accession MIMAT0000940
Sequence

70 -  

cugaaguguuuggggggacuc

 - 90

Get sequence
Evidence experimental; 5'RACE [1-2], Northern [1], PCR [1], MPSS [3], 454 [4], Illumina [5]

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).