Stem-loop sequence ath-MIR395d

AccessionMI0001010 (change log)
DescriptionArabidopsis thaliana miR395d stem-loop
Gene family MIPF0000016; MIR395
Literature search

25 open access papers mention ath-MIR395d
(106 sentences)

Stem-loop 
      u c  ua         ug         u     --au      uuca 
5' aug c uc  gaguucucc  aacacuuca uggaa    uuguua    g
   ||| | ||  |||||||||  ||||||||| |||||    ||||||     
3' uac g ag  cucaagggg  uugugaagu accuu    gacaau    u
      u u  cc         gu         c     aauu      cgaa
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 26269979-26270078 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR395d
ath-MIR395fchr1: 26273858-26273969 [+]
ath-MIR395echr1: 26272776-26272870 [-]
ath-MIR395dchr1: 26269979-26270078 [-]
Database links

Mature sequence ath-miR395d

Accession MIMAT0000941
Sequence

70 -  

cugaaguguuugggggaacuc

 - 90

Get sequence
Evidence experimental; 5'RACE [1], Northern [1], PCR [1], MPSS [2], 454 [3], Illumina [4]

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
3
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
4
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).