miRBase entry: ath-MIR395f

Stem-loop ath-MIR395f


Accession
MI0001012
Description
Arabidopsis thaliana ath-MIR395f precursor miRNA

Literature search
25 open access papers mention ath-MIR395f
(106 sentences)

Sequence


auguccccuugaguucccuuaaacgcuucauuguucauacuuuguuaucaucuaucgaucgaucaaucaaucugaugaacaCUGAAGUGUUUGGGGGGACUCuaggugacau
(((((.(((.((((((((((((((((((((.(((((((...(((((((((((....))).))).)).)))....))))))).)))))))))))))))))))).))).)))))

Structure
     c   u                    u       -acu   -  -   -   u 
auguc ccu gaguucccuuaaacgcuuca uguucau    uug uu auc auc a
||||| ||| |||||||||||||||||||| |||||||    ||| || ||| |||  
uacag gga CUCAGGGGGGUUUGUGAAGU acaagua    aac aa uag uag u
     u   u                    C       gucu   u  c   c   c 


Annotation confidence Low
Do you think this miRNA is real?
Comments
This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1].

Genome context
chr1: 26273858-26273969 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from ath-MIR395f
Name Accession Chromosome Start End Strand Confidence




Database links

Mature ath-miR395f

Accession MIMAT0000943
Description Arabidopsis thaliana ath-miR395f mature miRNA
Sequence 82 - CUGAAGUGUUUGGGGGGACUC - 102
Evidence experimental
5'RACE [1], Northern [1], PCR [1], MPSS [2], 454 [3], Illumina [4]

References

  1. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  2. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  3. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177

  4. PubMed ID: 15200956
    Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
    "Jones-Rhoades MW, Bartel DP"
    "Mol Cell (2004) 14:787-799