Stem-loop sequence ath-MIR397a

Accession MI0001015
Description Arabidopsis thaliana miR397a stem-loop
Gene family MIPF0000120; MIR397
Stem-loop 
-u   u      c                a     u   g     uuu      g 
  gaa gaacau auugagugcagcguug uguaa uuc uuuug   uucauu u
  ||| |||||| |||||||||||||||| ||||| ||| |||||   ||||||  
  cuu uuugua uaacucgcguugcgac auauu aag aaaau   agguaa u
au   -      u                c     u   -     --u      g
Get sequence
Deep sequencing
517 reads, 6 experiments
Comments

This sequence belongs to the miR397 family of miRNAs, which are predicted to target mRNAs coding for laccases and beta-6 tubulin [1].

Genome context
Coordinates (TAIR10) Overlapping transcripts
chr4: 2625950-2626056 [+]
intergenic

Mature sequence ath-miR397a

Accession MIMAT0000946
Sequence

11 -  

ucauugagugcagcguugaug

 - 31

Get sequence
Deep sequencing 517 reads, 6 experiments
Evidence experimental; 5'RACE [1], PCR [1], cloned [2-3], 454 [4-5]
Validated targets

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).