Stem-loop ath-MIR398b

Accession

MI0001018

Description

Arabidopsis thaliana ath-MIR398b precursor miRNA

Literature search

28 open access papers mention ath-MIR398b
(153 sentences)

Sequence

uggaucucgacAGGGUUGAUAUGAGAACACACgaguaaucaacggcuguaaugacgcuacgucauuguuacagcucucguuuucaUGUGUUCUCAGGUCACCCCUGcugagcucuu
.(((.((((.(((((.((((.((((((((((.(((.(((....(((((((((((((...))))))...)))))))...)))))).)))))))))).)))).))))).)))).))).

Structure

u   u    a     U    A          C   u   caac       ---      c 
 gga cucg cAGGG UGAU UGAGAACACA gag aau    ggcugua   augacg  
 ||| |||| ||||| |||| |||||||||| ||| |||    |||||||   |||||| u
 ucu gagu GUCCC ACUG ACUCUUGUGU cuu uug    ucgacau   uacugc  
u   c    c     C    G          a   -   -cuc       ugu      a 

Annotation confidence Not enough data

Comments

This sequence belongs to the miR398 family of miRNAs, which are predicted to target mRNAs coding for copper superoxide dismutases and cytochrome C oxidase subunit V [1].

Genome context

chr5: 4691022-4691137 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from ath-MIR398b

Mature ath-miR398b-3p

• Accession: MIMAT0000949
• Description: Arabidopsis thaliana ath-miR398b-3p mature miRNA
• Sequence: 86 - UGUGUUCUCAGGUCACCCCUG - 106
• Evidence: experimental ; 5'RACE [1], Northern [1-2], PCR [1], cloned [2-3], 3'RACE [3], 454 [4-5], MPSS [4]

Mature ath-miR398b-5p

• Accession: MIMAT0031911
• Description: Arabidopsis thaliana ath-miR398b-5p mature miRNA
• Sequence: 12 - AGGGUUGAUAUGAGAACACAC - 32
• Evidence: not_experimental

References

1. PubMed ID: 16040653
   Expression of Arabidopsis MIRNA genes
   "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
   "Plant Physiol (2005) 138:2145-2154


2. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


3. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


4. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799


5. PubMed ID: 15258262
   Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis
   "Sunkar R, Zhu JK"
   "Plant Cell (2004) 16:2001-2019