![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR395b |
||||||||||||||||
Accession | MI0001028 (change log) | |||||||||||||||
Description | Oryza sativa miR395b stem-loop | |||||||||||||||
Gene family | MIPF0000016; MIR395 | |||||||||||||||
Literature search |
![]()
41 open access papers mention osa-MIR395b | |||||||||||||||
Stem-loop |
ga u c u c g a 5' g c cuaggaguuccuu caagcacuuuacgaca acu u u | | ||||||||||||| |||||||||||||||| ||| | 3' c g gauucucaagggg guuugugaagugcugu uga a u cg u u - - g g |
|||||||||||||||
Deep sequencing |
| |||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||
Comments |
This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1]. Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the genes have been renamed to reflect this arrangement [2]. |
|||||||||||||||
Genome context |
|
|||||||||||||||
Clustered miRNAs |
|
|||||||||||||||
Database links |
|
Mature sequence osa-miR395b |
|
Accession | MIMAT0000959 |
Sequence |
56 - gugaaguguuugggggaacuc - 76 |
Deep sequencing | 48 reads, 2 experiments |
Evidence | by similarity; MI0001007 |
Database links |
|
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 |
PMID:16117853
"Molecular evolution of the rice miR395 gene family"
Cell Res. 15:631-638(2005).
|