Stem-loop sequence osa-MIR395b

AccessionMI0001028 (change log)
DescriptionOryza sativa miR395b stem-loop
Gene family MIPF0000016; MIR395
Literature search

41 open access papers mention osa-MIR395b
(171 sentences)

Stem-loop 
   ga u c             u                c   g a 
5'   g c cuaggaguuccuu caagcacuuuacgaca acu u u
     | | ||||||||||||| |||||||||||||||| ||| |  
3'   c g gauucucaagggg guuugugaagugcugu uga a u
   cg u u             -                -   g g
Get sequence
Deep sequencing
65 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1]. Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the genes have been renamed to reflect this arrangement [2].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 31805334-31805419 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR395b
osa-MIR395aChr4: 31805494-31805635 [-]
osa-MIR395bChr4: 31805334-31805419 [-]
osa-MIR395cChr4: 31805193-31805281 [-]
osa-MIR395dChr4: 31805055-31805142 [-]
osa-MIR395eChr4: 31804912-31804999 [-]
osa-MIR395fChr4: 31804774-31804855 [-]
osa-MIR395gChr4: 31804633-31804718 [-]
Database links

Mature sequence osa-miR395b

Accession MIMAT0000959
Sequence

56 -  

gugaaguguuugggggaacuc

 - 76

Get sequence
Deep sequencing48 reads, 2 experiments
Evidence by similarity; MI0001007
Database links

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).