Stem-loop sequence osa-MIR395g

AccessionMI0001031 (change log)
DescriptionOryza sativa miR395g stem-loop
Gene family MIPF0000016; MIR395
Literature search

39 open access papers mention osa-MIR395g
(167 sentences)

Stem-loop 
   guau  c  u         u             --u    cua 
5'     ca cg gaguucccu cgaacacuucacg   ggca   u
       || || ||||||||| |||||||||||||   ||||   u
3'     gu gc cucaagggg guuugugaagugu   ccgu   u
   uacu  a  u         -             uau    aac
Get sequence
Deep sequencing
39 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1]. Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the genes have been renamed to reflect this arrangement [2].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 31804633-31804718 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR395g
osa-MIR395aChr4: 31805494-31805635 [-]
osa-MIR395bChr4: 31805334-31805419 [-]
osa-MIR395cChr4: 31805193-31805281 [-]
osa-MIR395dChr4: 31805055-31805142 [-]
osa-MIR395eChr4: 31804912-31804999 [-]
osa-MIR395fChr4: 31804774-31804855 [-]
osa-MIR395gChr4: 31804633-31804718 [-]
Database links

Mature sequence osa-miR395g

Accession MIMAT0000962
Sequence

56 -  

gugaaguguuugggggaacuc

 - 76

Get sequence
Deep sequencing39 reads, 2 experiments
Evidence by similarity; MI0001007
Database links

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).