Stem-loop sequence osa-MIR395k

AccessionMI0001035 (change log)
DescriptionOryza sativa miR395k stem-loop
Gene family MIPF0000016; MIR395
Literature search

39 open access papers mention osa-MIR395k
(167 sentences)

Stem-loop 
   guuu           u                  ------       uc  u 
5'     uaucgggaguu ccuucaagcacuucacgu      agagcuu  ua u
       ||||||||||| ||||||||||||||||||      |||||||  ||  
3'     auaguucucaa ggggguuugugaagugua      uuucgag  au g
   aacc           -                  acaagg       gu  a
Get sequence
Deep sequencing
45 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1]. Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the genes have been renamed to reflect this arrangement [2].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 3299652-3299750 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR395k
osa-MIR395hChr8: 3299144-3299255 [+]
osa-MIR395iChr8: 3299319-3299417 [+]
osa-MIR395jChr8: 3299479-3299590 [+]
osa-MIR395kChr8: 3299652-3299750 [+]
osa-MIR395yChr8: 3299815-3299924 [+]
osa-MIR395lChr8: 3299997-3300090 [+]
Database links

Mature sequence osa-miR395k

Accession MIMAT0000966
Sequence

69 -  

gugaaguguuugggggaacuc

 - 89

Get sequence
Deep sequencing37 reads, 2 experiments
Evidence by similarity; MI0001007
Database links

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).