Stem-loop sequence osa-MIR395s

Accession

MI0001037 (change log)

Previous IDs

osa-MIR395m

Description

Oryza sativa miR395s stem-loop

Gene family

MIPF0000016; MIR395

Literature search

40 open access papers mention osa-MIR395s
(167 sentences)

Stem-loop

   guau  c  u         u             --u    cua 
5'     ca cg gaguucccu caagcacuucacg   ggca   u
       || || ||||||||| |||||||||||||   ||||   u
3'     gu gc cucaagggg guuugugaagugu   ccgu   u
   ccuu  a  u         -             uau    aac 

Deep sequencing

48 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1]. Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the genes have been renamed to reflect this arrangement [2].

Genome context

• Coordinates (MSU7): Chr4: 32622943-32623028 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from osa-MIR395s

• osa-MIR395m: Chr4: 32621993-32622112 [+]
• osa-MIR395n: Chr4: 32622243-32622308 [+]
• osa-MIR395o: Chr4: 32622381-32622449 [+]
• osa-MIR395p: Chr4: 32622525-32622592 [+]
• osa-MIR395q: Chr4: 32622668-32622735 [+]
• osa-MIR395r: Chr4: 32622811-32622878 [+]
• osa-MIR395s: Chr4: 32622943-32623028 [+]
• osa-MIR395x: Chr4: 32623067-32623162 [+]

Database links

• miRBase Tracker:MI0001037

Mature sequence osa-miR395s

• Accession: MIMAT0000968
• Previous IDs: osa-miR395m
• Sequence: 56 - gugaaguguuugggggaacuc - 76
• Deep sequencing: 39 reads, 2 experiments
• Evidence: by similarity; MI0001007
• Database links:
  • RNAcentral:URS000034BBE9_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).