Stem-loop osa-MIR395t

Accession

MI0001038

Description

Oryza sativa osa-MIR395t precursor miRNA

Gene family

MIPF0000016; MIR395

Literature search

39 open access papers mention osa-MIR395t
(170 sentences)

Sequence

uuauccacuggaguucuccucaaaccacuucagcagauagcuagcuaggccucauugcauugcaccacuguugcauaacuaugagcauggggccaaaaguuagcugcuuauaGUGAAGUGUUUGGGGAAACUCcgguuggcaa
....(((((((((((.(((((((((.((((((..((.(((((((((.((((((((.((..((((.......)))).........))))))))))...))))))))))).....))))))))))))))))))))))).)))...

Structure

uuau   -        c         c      ---gc  a         --a        u  -------au    cc 
    cca cuggaguu uccucaaac acuuca     ag uagcuagcu   ggccucau gc         ugca  a
    ||| |||||||| ||||||||| ||||||     || |||||||||   |||||||| ||         ||||  c
    ggu ggcCUCAA AGGGGUUUG UGAAGU     uc gucgauuga   ccggggua cg         acgu  u
-aac   u        -         -      Gauau  -         aaa        -  aguaucaau    ug 

Annotation confidence Not enough data

Comments

This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1]. Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the genes have been renamed to reflect this arrangement [2].

Genome context

Chr9: 6607353-6607495 [-]

Clustered miRNAs

3 other miRNAs are < 10 kb from osa-MIR395t

Mature osa-miR395t

• Accession: MIMAT0000969
• Description: Oryza sativa osa-miR395t mature miRNA
• Sequence: 113 - GUGAAGUGUUUGGGGAAACUC - 133
• Evidence: not_experimental

References

1. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799


2. PubMed ID: 16117853
   Molecular evolution of the rice miR395 gene family
   "Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L"
   "Cell Res (2005) 15:631-638