![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR399b |
|||||
Accession | MI0001054 (change log) | ||||
Description | Oryza sativa miR399b stem-loop | ||||
Gene family | MIPF0000015; MIR399 | ||||
Literature search |
![]()
59 open access papers mention osa-MIR399b | ||||
Stem-loop |
guga ca u c - aga gc aa 5' gaau cag gcgauucuccu uggcauggca ug g cu a |||| ||| ||||||||||| |||||||||| || | || a 3' cuua guc cguuaagagga accgugccgu ac c ga a aaga cc c a c --g -a ga |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR399b |
|
Accession | MIMAT0000985 |
Sequence |
67 - ugccaaaggagaauugcccug - 87 |
Deep sequencing | 6 reads, 2 experiments |
Evidence | by similarity; MI0001020 |
Database links |
|
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|