Stem-loop sequence osa-MIR399b

Accession

MI0001054 (change log)

Description

Oryza sativa miR399b stem-loop

Gene family

MIPF0000015; MIR399

Literature search

59 open access papers mention osa-MIR399b
(228 sentences)

Stem-loop

   guga    ca   u           c          -  aga gc  aa 
5'     gaau  cag gcgauucuccu uggcauggca ug   g  cu  a
       ||||  ||| ||||||||||| |||||||||| ||   |  ||  a
3'     cuua  guc cguuaagagga accgugccgu ac   c  ga  a
   aaga    cc   c           a          c  --g -a  ga 

Deep sequencing

8 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context

• Coordinates (MSU7): Chr2: 7664026-7664122 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001054

Mature sequence osa-miR399b

• Accession: MIMAT0000985
• Sequence: 67 - ugccaaaggagaauugcccug - 87
• Deep sequencing: 6 reads, 2 experiments
• Evidence: by similarity; MI0001020
• Database links:
  • RNAcentral:URS000028246C_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).