Stem-loop sequence osa-MIR399g

Accession

MI0001059 (change log)

Description

Oryza sativa miR399g stem-loop

Gene family

MIPF0000015; MIR399

Literature search

58 open access papers mention osa-MIR399g
(226 sentences)

Stem-loop

   au   c     a      cua    a        --       -  ug  ua    uau   u 
5'   gug auugc gggcaa   cucc uuggcaga  gggaugg au  ga  ugga   ggc g
     ||| ||||| ||||||   |||| ||||||||  ||||||| ||  ||  ||||   |||  
3'   cac uagcg cccguu   gagg aaccgucu  cccuacc ua  uu  accu   ucg a
   cu   u     a      -ua    a        au       c  gu  --    ---   u 

Deep sequencing

10 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context

• Coordinates (MSU7): Chr2: 7675284-7675402 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001059

Mature sequence osa-miR399g

• Accession: MIMAT0000990
• Sequence: 89 - ugccaaaggagauuugcccag - 109
• Deep sequencing: 7 reads, 2 experiments
• Evidence: by similarity; MI0001025

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).