Stem-loop sequence ebv-mir-BART1

Accession MI0001067
Description Epstein Barr virus miR-BART1 stem-loop
Gene family MIPF0000325; mir-BART1
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-BART1_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-BART1 microRNA precursor is found in Human herpesvirus 4 (Epstein-Barr virus) and Cercopithicine herpesvirus 15. mir-BART1 is found in all stages of infection but expression is significantly elevated in the lytic stage. In Epstein-Barr virus, mir-BART1 is found in the intronic regions of the BART (Bam HI-A region rightward transcript) gene whose function is unknown. The mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
-   g --u u       -    ac        a  a 
 ggg g   c uagugga agug  gugcugug au c
 ||| |   | ||||||| ||||  |||||||| ||  
 ccc c   g aucaccu ucgc  cacgauac ug a
g   g ucu u       a    --        c  g
Get sequence
Comments

Pfeffer et al. cloned 5 miRNAs from a Burkitt's lymphoma cell line (BL41) infected with the B95-8 strain of Epstein-Barr virus [1]. They were all confirmed by Northern blot. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 139346-139415 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BART1
ebv-mir-BART3 HHV507799: 139076-139154 [+]
ebv-mir-BART4 HHV507799: 139220-139295 [+]
ebv-mir-BART1 HHV507799: 139346-139415 [+]
ebv-mir-BART15 HHV507799: 139507-139584 [+]
ebv-mir-BART5 HHV507799: 139661-139749 [+]
ebv-mir-BART16 HHV507799: 139776-139874 [+]
ebv-mir-BART17 HHV507799: 139894-139995 [+]
ebv-mir-BART6 HHV507799: 140016-140107 [+]
ebv-mir-BART21 HHV507799: 145503-145578 [+]
ebv-mir-BART18 HHV507799: 145932-146050 [+]
ebv-mir-BART7 HHV507799: 146425-146510 [+]
ebv-mir-BART8 HHV507799: 146759-146840 [+]
ebv-mir-BART9 HHV507799: 146946-147032 [+]
ebv-mir-BART22 HHV507799: 147161-147231 [+]
ebv-mir-BART10 HHV507799: 147304-147393 [+]
ebv-mir-BART11 HHV507799: 147524-147609 [+]
ebv-mir-BART12 HHV507799: 147888-147970 [+]
ebv-mir-BART19 HHV507799: 148198-148290 [+]
ebv-mir-BART20 HHV507799: 148319-148417 [+]
ebv-mir-BART13 HHV507799: 148512-148597 [+]
ebv-mir-BART14 HHV507799: 148731-148815 [+]

Mature sequence ebv-miR-BART1-5p

Accession MIMAT0000999
Previous IDs ebv-miR-BART1
Sequence

6 -  

ucuuaguggaagugacgugcugug

 - 29

Get sequence
Evidence experimental; cloned [1,3], Northern [1]

Mature sequence ebv-miR-BART1-3p

Accession MIMAT0003390
Sequence

42 -  

uagcaccgcuauccacuauguc

 - 63

Get sequence
Evidence experimental; cloned [2-3]

References

1
PMID:15118162 "Identification of virus-encoded microRNAs" Pfeffer S, Zavolan M, Grasser FA, Chien M, Russo JJ, Ju J, John B, Enright AJ, Marks D, Sander C, Tuschl T Science. 304:734-736(2004).
2
PMID:16557291 "Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed" Cai X, Schafer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR PLoS Pathog. 2:e23(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).