|
miRBase |
|
Stem-loop sequence ebv-mir-BART2 |
||||||||||||||||||||||||||||||
| Accession | MI0001068 | |||||||||||||||||||||||||||||
| Description | Epstein Barr virus miR-BART2 stem-loop | |||||||||||||||||||||||||||||
| Stem-loop |
ac g -u - uguc uauuuucu ca ucgc ccuugcg c |||||||| || |||| ||||||| auaaaaga gu agcg ggaacgu a aa g uu a uguu |
|||||||||||||||||||||||||||||
| Comments |
Pfeffer et al. cloned 5 miRNAs from a Burkitt's lymphoma cell line (BL41) infected with the B95-8 strain of Epstein-Barr virus [1]. They were all confirmed by Northern blot. The mature miRNA names reflect cloning frequencies from Landgraf et al. [2], and may differ subtly from previous annotations. |
|||||||||||||||||||||||||||||
| Genome context |
|
|||||||||||||||||||||||||||||
| Clustered miRNAs |
|
|||||||||||||||||||||||||||||
Mature sequence ebv-miR-BART2-5p |
|
| Accession | MIMAT0001000 |
| Previous IDs | ebv-miR-BART2 |
| Sequence |
3 - uauuuucugcauucgcccuugc - 24 |
| Evidence | experimental; cloned [1-2], Northern [1] |
| Validated targets |
|
Mature sequence ebv-miR-BART2-3p |
|
| Accession | MIMAT0004744 |
| Sequence |
39 - aaggagcgauuuggagaaaauaaa - 62 |
| Evidence | experimental; cloned [2] |
References |
|
| 1 |
PMID:15118162
"Identification of virus-encoded microRNAs"
Science. 304:734-736(2004).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|