![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR400 |
||||||
Accession | MI0001069 (change log) | |||||
Description | Arabidopsis thaliana miR400 stem-loop | |||||
Gene family | MIPF0001157; MIR400 | |||||
Literature search |
![]()
7 open access papers mention ath-MIR400 | |||||
Stem-loop |
--u a ug g a a gu a 5' gagg u uuuaugaga uauuauaagucacu c uuug aagcaa g |||| | ||||||||| |||||||||||||| | |||| |||||| 3' uuuu g aaguacucu auaguauucaguga g aaac uuuguu u acg a gu a a c uc g |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence ath-miR400 |
|
Accession | MIMAT0001001 |
Sequence |
12 - uaugagaguauuauaagucac - 32 |
Evidence | experimental; cloned [1], Northern [1], 454 [2-3], MPSS [2], Illumina [4] |
References |
|
1 |
PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"
Plant Cell. 16:2001-2019(2004).
|
2 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
3 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
4 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|