Stem-loop sequence ath-MIR406

AccessionMI0001078 (change log)
DescriptionArabidopsis thaliana miR406 stem-loop
Literature search

1 open access papers mention ath-MIR406
(1 sentences)

Stem-loop
   uaaa    uaa          uca      agcacauaucaau    --       a     c    auuaguucuuaaa          agacaguaacuauucaaauagaaug 
5'     gucu   uuuuuaguua   cgauuu             cuau  agauuug uuuuu uuuu             uuuugauuug                         c
       ||||   ||||||||||   ||||||             ||||  ||||||| ||||| ||||             ||||||||||                          
3'     uagg   aaaaaucaau   gcuaaa             gaua  ucugagc aaaaa aaaa             aaaacuaagc                         u
   --gg    ---          -ua      ----------aau    cu       -     a    -------------          aaagaaagccuaagaccuaauguua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 19430078-19430277 [-]
intergenic
Database links

Mature sequence ath-miR406

Accession MIMAT0001009
Sequence

107 - 

uagaaugcuauuguaauccag

 - 127

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).