Stem-loop sequence ath-MIR407

AccessionMI0001079 (change log)
DescriptionArabidopsis thaliana miR407 stem-loop
Stem-loop
   ---                     c         u          caa                         a   a                    c    cc            a       a  c  a 
5'    ugggaaaaauguuaaaaaaau gccaacuuu aaaaauggga   aaaaaucgccaacuccugaaauguc uuu aaucauauacuuuugguuga uuuu  agaaagauaaua agcaaag uu gu a
      ||||||||||||||||||||| ||||||||| ||||||||||   ||||||||||||||||||||||||| ||| |||||||||||||||||||| ||||  |||||||||||| ||||||| || || u
3'    accuuuuuuacaguuuuuuua cgguugaaa uuuuuacccu   uuuuuagugguugaggacuuuacag aaa uuaguguaugaaaacuaacu aaga  ucuuucuauugu ucguuuc aa ca c
   gua                     a         c          -ac                         c   a                    c    aa            c       a  a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

MIR407a and MIR407b published by Sunkar and Zhu [1] map to the same locus on NC_003071.3.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 13866205-13866467 [+]
intergenic
Database links

Mature sequence ath-miR407

Accession MIMAT0001010
Sequence

72 - 

uuuaaaucauauacuuuuggu

 - 92

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).